ampk α 1 shrna lentiviral particles  (Santa Cruz Biotechnology)

Journal: Oxidative Medicine and Cellular Longevity

Article Title: Luteolin Protects Chondrocytes from H 2 O 2 -Induced Oxidative Injury and Attenuates Osteoarthritis Progression by Activating AMPK-Nrf2 Signaling

doi: 10.1155/2022/5635797

Figure Lengend Snippet: Luteolin activated AMPK and Nrf2 signaling in primary murine chondrocytes. Primary murine chondrocytes were treated with the indicated concentration of luteolin or vehicle control (0.2% DMSO, Veh). The Keap1/Nrf2 interaction was examined by coimmunoprecipitation (Co-IP) (a). The expression of the indicated proteins was examined by western blotting (b, c). Protein (d, g) and mRNA (e) expressions of the indicated proteins in total cell lysates are presented. ARE and AMPK activities were examined (f, h). The data are presented as the mean ± SD. ∗ P < 0.05 vs. the Ctrl group.

Article Snippet: Nrf2 shRNA and AMPK α 1 shRNA lentiviral particles (Santa Cruz Biotech, Santa Cruz, CA) were individually added to cultured primary murine chondrocytes for 24 h, followed by puromycin selection for 12 days.

Techniques: Concentration Assay, Control, Co-Immunoprecipitation Assay, Expressing, Western Blot

Journal: Oxidative Medicine and Cellular Longevity

Article Title: Luteolin Protects Chondrocytes from H 2 O 2 -Induced Oxidative Injury and Attenuates Osteoarthritis Progression by Activating AMPK-Nrf2 Signaling

doi: 10.1155/2022/5635797

Figure Lengend Snippet: Nrf2 signaling activation mediated luteolin-induced cytoprotection from H 2 O 2 . Stable primary murine chondrocytes with the indicated Nrf2 shRNA (sh-Nrf2) or the CRISPR/Cas9-Nrf2-KO-GFP construct (ko-Nrf2), as well as control cells with scramble control shRNA (sh-C), were established and cultured, and the expression of the indicated genes was measured (a, b). Cells were treated for 2 h with luteolin (20 μ M), followed by H 2 O 2 (300 μ M) stimulation for the indicated times. Cell viability (c) and apoptosis (d) were measured by CCK-8 and Trypan blue assays, respectively. (e) Mitochondrial depolarization was tested. Quantified values are the mean ± SD. ∗ P < 0.05 vs. the Ctrl group. # P < 0.05 vs. “sh-C” cells.

Article Snippet: Nrf2 shRNA and AMPK α 1 shRNA lentiviral particles (Santa Cruz Biotech, Santa Cruz, CA) were individually added to cultured primary murine chondrocytes for 24 h, followed by puromycin selection for 12 days.

Techniques: Activation Assay, shRNA, CRISPR, Construct, Control, Cell Culture, Expressing, CCK-8 Assay

Journal: Oxidative Medicine and Cellular Longevity

Article Title: Luteolin Protects Chondrocytes from H 2 O 2 -Induced Oxidative Injury and Attenuates Osteoarthritis Progression by Activating AMPK-Nrf2 Signaling

doi: 10.1155/2022/5635797

Figure Lengend Snippet: AMPK activation mediated luteolin-induced cytoprotection against H 2 O 2 . Stable primary murine chondrocytes with the indicated AMPK α 1 shRNA (sh-AMPK α 1) or the CRISPR/Cas9-Nrf2-KO-GFP construct (ko-AMPK α 1), as well as control cells with scramble control shRNA (sh-C), were established and cultured, and the expression of the indicated genes was examined (a). Cells were treated for 2 h with luteolin (20 μ M), followed by H 2 O 2 (300 μ M) stimulation for the indicated times. Cell viability (b) and apoptosis (c) were measured by CCK-8 and Trypan blue assays, respectively. (d, e) Mitochondrial depolarization was tested. Quantified values are the mean ± SD. ∗ P < 0.05 vs. the Ctrl group. # P < 0.05 vs. “sh-C” cells.

Article Snippet: Nrf2 shRNA and AMPK α 1 shRNA lentiviral particles (Santa Cruz Biotech, Santa Cruz, CA) were individually added to cultured primary murine chondrocytes for 24 h, followed by puromycin selection for 12 days.

Techniques: Activation Assay, shRNA, CRISPR, Construct, Control, Cell Culture, Expressing, CCK-8 Assay

Journal: Oxidative Medicine and Cellular Longevity

Article Title: Luteolin Protects Chondrocytes from H 2 O 2 -Induced Oxidative Injury and Attenuates Osteoarthritis Progression by Activating AMPK-Nrf2 Signaling

doi: 10.1155/2022/5635797

Figure Lengend Snippet: AMPK downstream Nrf2 signaling activation was required for luteolin-induced cytoprotection from H 2 O 2 . Stable primary murine chondrocytes with AMPK α 1 shRNA (“sh-AMPK α 1”) and CRISPR/Cas-9 AMPK α 1-KO construct (“ko-AMPK α 1”), as well as control cells with scramble control shRNA (sh-C), were treated with luteolin (20 μ M) for 2 h, followed by H 2 O 2 stimulation for 4 h. The protein and mRNA expressions of the indicated genes were presented (a, b). Stable primary murine chondrocytes with Nrf2 shRNA (“sh-Nrf2” cells) and CRISPR/Cas-9 Nrf2-KO constructs (“ko-Nrf2” cells), as well as control cells with scramble control shRNA (sh-C), were treated with luteolin (20 μ M) for 2 h, followed by H 2 O 2 stimulation for 48 h. The expressions of the indicated proteins were shown (c). The data are the mean ± SD. ∗ P < 0.05 vs. “sh-C” cells (a, b).

Article Snippet: Nrf2 shRNA and AMPK α 1 shRNA lentiviral particles (Santa Cruz Biotech, Santa Cruz, CA) were individually added to cultured primary murine chondrocytes for 24 h, followed by puromycin selection for 12 days.

Techniques: Activation Assay, shRNA, CRISPR, Construct, Control

Journal: Oxidative Medicine and Cellular Longevity

Article Title: Luteolin Protects Chondrocytes from H 2 O 2 -Induced Oxidative Injury and Attenuates Osteoarthritis Progression by Activating AMPK-Nrf2 Signaling

doi: 10.1155/2022/5635797

Figure Lengend Snippet: Schematic of the chondroprotective effect of luteolin via the AMPK/Nrf2 pathway. Luteolin protected chondrocytes against H 2 O 2 -induced oxidative stress and inflammation by increasing levels of phosphorylated AMPK and activating Nrf2, which translocates into the nucleus to increase the transcription and expression of Nrf2-target genes, such as HO-1, NQO1, and GCLC.

Article Snippet: Nrf2 shRNA and AMPK α 1 shRNA lentiviral particles (Santa Cruz Biotech, Santa Cruz, CA) were individually added to cultured primary murine chondrocytes for 24 h, followed by puromycin selection for 12 days.

Techniques: Expressing

Journal: bioRxiv

Article Title: Type I Interferon Signaling Drives Microglial Dysfunction and Senescence in Human iPSC Models of Down Syndrome and Alzheimer’s Disease

doi: 10.1101/2021.12.22.473858

Figure Lengend Snippet: (A) qPCR results of genomic DNA showing the relative OLIG2, IFNAR1, and IFNAR2 DNA copy numbers in Cont (Cont1, Cont2, and Di-DS3) and DS (DS1, DS2, and Tri-DS3) PMPs (n = 3, each experiment was repeated three times). Student’s t test, *** P < 0.001. Data are presented as mean ± SEM. (B) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression in three pairs of Cont and DS hiPSC derived PMPs. (n = 5, the data were pooled from the three pairs of Cont and DS hiPSC-derived PMPs, Student’s t test, *** P <0.001. Data are presented as mean ± SEM.

Article Snippet: IFNAR1 shRNA (sc-35637-V), IFNAR2 shRNA (sc-40091-V), and non-targeting control shRNA (sc-108080) lentiviral particles were purchased from Santa Cruz Biotechnology.

Techniques: Expressing, Derivative Assay

Journal: bioRxiv

Article Title: Type I Interferon Signaling Drives Microglial Dysfunction and Senescence in Human iPSC Models of Down Syndrome and Alzheimer’s Disease

doi: 10.1101/2021.12.22.473858

Figure Lengend Snippet: (A) A schematic diagram showing the experimental design. This drawing created using BioRender.com. (B) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression in chimeric mice at week 8 and month 4 (n = 4-5 mice per group). Student’s t test, * P < 0.05 and ** P < 0.01. Data are presented as mean ± SEM. (C, D) Flow cytometry analysis and quantification of IFNAR1 and IFNAR2 expression in 4 months old Cont and DS chimeric mice (n = 4). Student’s t test, * P < 0.05. Data are presented as mean ± SEM. (E) Representative images of hTMEM119PSD95 staining in 8-week-old Cont, DS + Cont shRNA , and DS +IFNAR1/2 shRNA chimeras (n = 115-136 microglia from 3-4 mice per group). Arrows indicate PSD95 + puncta. Scale bars:5 μm and 1 μm in the original and enlarged images, respectively. (F) Representative images of hTMEM119 + CD68 + PSD95 + microglia in 8-week-old Cont, DS + Cont shRNA , and DS +IFNAR1/2 shRNA chimeras (n = 113-135 microglia from 3-4 mice per group). Arrows indicate PSD95 + puncta in the CD68 + phagolysosome. Scale bars:5 μm and 1 μm in the original and enlarged images, respectively. (G) Quantification of microglial volume, process length, branch numbers, and endpoints (n = 115-136 from 3-4 mice per group), One-way ANOVA test. * P < 0.05, **p < 0.01 and ***p < 0.00. Data are presented as mean ± SEM. (H) Quantification of PSD95 + puncta in hTMEM119 + microglia (n = 115-133 microglia from 3-4 mice per group). One-way ANOVA test, * P < 0.05, **p < 0.01 and ***p < 0.001. Data are presented as mean ± SEM. (I, J). Quantification of CD68 + phagolysosomes and PSD95 + puncta in CD68 + phagolysosomes (n = 113-136 microglia from 3-4 mice per group). One-way ANOVA test, * P < 0.05, **p < 0.01 and ***p < 0.001. Data are presented as mean ± SEM.

Article Snippet: IFNAR1 shRNA (sc-35637-V), IFNAR2 shRNA (sc-40091-V), and non-targeting control shRNA (sc-108080) lentiviral particles were purchased from Santa Cruz Biotechnology.

Techniques: Expressing, Flow Cytometry, Staining, shRNA

Journal: bioRxiv

Article Title: Type I Interferon Signaling Drives Microglial Dysfunction and Senescence in Human iPSC Models of Down Syndrome and Alzheimer’s Disease

doi: 10.1101/2021.12.22.473858

Figure Lengend Snippet: (A) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression in three pairs of Cont and DS hiPSC lines. (n = 3, each experiment was repeated three times), Student’s t test, *** P <0.001. Data are presented as mean ± SEM. (B) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression in two DS hiPSC lines expressing IFNAR1/2 shRNA or Cont shRNA , (n = 5, each experiment was repeated five times), Student’s t test, *** P <0.001. Data are presented as mean ± SEM. (C) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression in 3-4-month-old chimeric mice, Cont, DS + Cont shRNA and DS + IFNAR1/2 shRNA chimeras (n = 3 mice per group). Student’s t test, * P < 0.05 and ** P < 0.01. Data are presented as mean ± SEM. (D) Western blotting analysis of IFNAR2 expression in DS, DS + Cont shRNA and DS + IFNAR1/2 shRNA microglia cells (n = 3, each experiment was repeated three times). One-way ANOVA test. *** P <0.001. Data are presented as mean ± SEM. (E) Representative images of hTMEM119 and hN in DS + Cont shRNA and DS + IFNAR1/2 shRNA in chimeric mice. Scale bar: 50 μm. (F) Quantification of the percentage of hTMEM119 in hN + cells in DS + Cont shRNA and DS + IFNAR1/2 shRNA chimeric mice (n = 7 mice per group). Student’s t test, NS , not significant. Data are presented as mean ± SEM. (G) Representative raw fluorescent super-resolution, 3D surface rendered, and 3D skeletonization images of hTMEM119 staining in Cont, and DS + Cont shRNA and DS + IFNAR1/2 shRNA chimeric mice. Scale bar: 5 μm. (H) Representative super-resolution and 3D surface rendered images showing hTMEM119 and CD68 staining in Cont, and DS + Cont shRNA and DS + IFNAR1/2 shRNA chimeric mice. Arrows indicate PSD95 + puncta in the CD68 + phagolysosome. Scale bar: 5 μm. (I) Quantification of microglial volume, process length, branch numbers and endpoints (n = 118-136 from 3-4 mice per group), One-way ANOVA test. * P < 0.05, ** P < 0.01 and *** P < 0.001. Data are presented as mean ± SEM. (J) Quantification of CD68 + phagolysosome volume (n = 128-136 from 3-4 mice per group). One-way ANOVA test, * P < 0.05 and ***p < 0.001. Data are presented as mean ± SEM.

Article Snippet: IFNAR1 shRNA (sc-35637-V), IFNAR2 shRNA (sc-40091-V), and non-targeting control shRNA (sc-108080) lentiviral particles were purchased from Santa Cruz Biotechnology.

Techniques: Expressing, shRNA, Western Blot, Staining

Journal: bioRxiv

Article Title: Type I Interferon Signaling Drives Microglial Dysfunction and Senescence in Human iPSC Models of Down Syndrome and Alzheimer’s Disease

doi: 10.1101/2021.12.22.473858

Figure Lengend Snippet: (A) Representative images of Iba + /hN + human microglia in Cont tau and DSAD tau groups. Arrows indicate Iba + /hN + human microglia. Asterisks indicate fragmented processes. Scale bars: 50 and 10 μm. (B) Representative images showing colocalization of hCD45 + and Ferritin + staining in Cont and DSAD tau groups. Arrows indicate Ferritin + and/or hCD45 + staining. Scale bar: 50 μm. (C) Quantification of the percentage of hN + in Iba-1 + cells in Cont and DSAD tau groups (n = 7 mice/group). Student’s t test, NS , not significant. Data are presented as mean ± SEM. (D) Quantification of the process length, soma size, soma size/process length cells (n=7 mice per group). Student’s t test, * P < 0.05, ** P < 0.01, *** P < 0.001, NS , not significant. Data are presented as mean ± SEM. (E) Quantification of the percentage of Ferritin in hCD45 + cells (n = 6-7 mice per group). Student’s t test, ** P < 0.01. Data are presented as mean ± SEM. (F) A Dot plot representing the expression of the inflammation-related genes IL1β , CCL2 , CCL4, CHI3L1, KLF2, NFKBIA identified from scRNA-seq. (G) qPCR analysis of IL-1B and TNFA mRNA expression (n = 4 mice per group). Student’s t test, * P < 0.05. Data represented as mean ± SEM. (H) qPCR analysis of IFNA1 and IFNB1 mRNA expression (n = 4 mice per group). Student’s t test, *** P < 0.001. Data represented as mean ± SEM. (I) Flow cytometry analysis showing the expression of IFNAR1 and IFNAR2 in Cont tau and DSAD tau group (n=2 mice per group). (J) Representative images of human microglia (Iba + hN + ) in DS+Cont shRNA +DSAD tau and DS+IFNAR1/2 shRNA +DSAD tau chimeric mice. Arrows indicate Iba + /hN + human microglia. Asterisks indicate fragmented processes. Scale bar: 50 and 10 μm. (K) Representative image showing colocalization of hCD45 + and Ferritin + staining in DS+Cont shRNA +DSAD tau and DS+IFNAR1/2 shRNA +DSAD tau chimeric mice. Arrows indicate Ferritin + and/or hCD45 + staining. Scale bar: 50 μm. (L) Quantification of the process length, soma size, soma size/process length (n = 4 mice per group). One-way ANOVA test, ** P < 0.01 and *** P < 0.001, NS , not significant. Data are presented as mean ± SEM. (M) Quantification of the percentage of Ferritin in hCD45 + cells (n = 5 mice per group). One-way ANOVA test, * P < 0.05, NS , not significant. Data are presented as mean ± SEM.

Article Snippet: IFNAR1 shRNA (sc-35637-V), IFNAR2 shRNA (sc-40091-V), and non-targeting control shRNA (sc-108080) lentiviral particles were purchased from Santa Cruz Biotechnology.

Techniques: Staining, Expressing, Flow Cytometry, shRNA

Journal: bioRxiv

Article Title: Type I Interferon Signaling Drives Microglial Dysfunction and Senescence in Human iPSC Models of Down Syndrome and Alzheimer’s Disease

doi: 10.1101/2021.12.22.473858

Figure Lengend Snippet: (A) Representative raw fluorescent super-resolution, 3D surface rendered, and 3D skeletonization images of mouse microglia (Iba + hN - ) in Cont tau and DSAD tau chimeric mice. Scale bar: 5 μm. (B) Quantification of the process length, branch numbers, and endpoints in mouse microglia (Iba + hN - ) (n = 7 mice per group), Student’s t test, *P < 0.05, ** P < 0.01. Data are presented as mean ± SEM. (C) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression (n = 4 mice per group). Student’s t test, NS , not significant. Data are presented as mean ± SEM. (D) qPCR analysis of IFNA1 and IFNB1 mRNA expression (n = 4 mice per group). Student’s t test, *** P < 0.001. Data are presented as mean ± SEM.

Article Snippet: IFNAR1 shRNA (sc-35637-V), IFNAR2 shRNA (sc-40091-V), and non-targeting control shRNA (sc-108080) lentiviral particles were purchased from Santa Cruz Biotechnology.

Techniques: Expressing

Journal: bioRxiv

Article Title: Type I Interferon Signaling Drives Microglial Dysfunction and Senescence in Human iPSC Models of Down Syndrome and Alzheimer’s Disease

doi: 10.1101/2021.12.22.473858

Figure Lengend Snippet: (A) qPCR results of genomic DNA showing the relative OLIG2, IFNAR1, and IFNAR2 DNA copy numbers in Cont (Cont1, Cont2, and Di-DS3) and DS (DS1, DS2, and Tri-DS3) PMPs (n = 3, each experiment was repeated three times). Student’s t test, *** P < 0.001. Data are presented as mean ± SEM. (B) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression in three pairs of Cont and DS hiPSC derived PMPs. (n = 5, the data were pooled from the three pairs of Cont and DS hiPSC-derived PMPs, Student’s t test, *** P <0.001. Data are presented as mean ± SEM.

Article Snippet: IFNAR1 shRNA (sc-35637-V), IFNAR2 shRNA (sc-40091-V), and non-targeting control shRNA (sc-108080) lentiviral particles were purchased from Santa Cruz Biotechnology.

Techniques: Expressing, Derivative Assay

Journal: bioRxiv

Article Title: Type I Interferon Signaling Drives Microglial Dysfunction and Senescence in Human iPSC Models of Down Syndrome and Alzheimer’s Disease

doi: 10.1101/2021.12.22.473858

Figure Lengend Snippet: (A) A schematic diagram showing the experimental design. This drawing created using BioRender.com. (B) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression in chimeric mice at week 8 and month 4 (n = 4-5 mice per group). Student’s t test, * P < 0.05 and ** P < 0.01. Data are presented as mean ± SEM. (C, D) Flow cytometry analysis and quantification of IFNAR1 and IFNAR2 expression in 4 months old Cont and DS chimeric mice (n = 4). Student’s t test, * P < 0.05. Data are presented as mean ± SEM. (E) Representative images of hTMEM119PSD95 staining in 8-week-old Cont, DS + Cont shRNA , and DS +IFNAR1/2 shRNA chimeras (n = 115-136 microglia from 3-4 mice per group). Arrows indicate PSD95 + puncta. Scale bars:5 μm and 1 μm in the original and enlarged images, respectively. (F) Representative images of hTMEM119 + CD68 + PSD95 + microglia in 8-week-old Cont, DS + Cont shRNA , and DS +IFNAR1/2 shRNA chimeras (n = 113-135 microglia from 3-4 mice per group). Arrows indicate PSD95 + puncta in the CD68 + phagolysosome. Scale bars:5 μm and 1 μm in the original and enlarged images, respectively. (G) Quantification of microglial volume, process length, branch numbers, and endpoints (n = 115-136 from 3-4 mice per group), One-way ANOVA test. * P < 0.05, **p < 0.01 and ***p < 0.00. Data are presented as mean ± SEM. (H) Quantification of PSD95 + puncta in hTMEM119 + microglia (n = 115-133 microglia from 3-4 mice per group). One-way ANOVA test, * P < 0.05, **p < 0.01 and ***p < 0.001. Data are presented as mean ± SEM. (I, J). Quantification of CD68 + phagolysosomes and PSD95 + puncta in CD68 + phagolysosomes (n = 113-136 microglia from 3-4 mice per group). One-way ANOVA test, * P < 0.05, **p < 0.01 and ***p < 0.001. Data are presented as mean ± SEM.

Article Snippet: IFNAR1 shRNA (sc-35637-V), IFNAR2 shRNA (sc-40091-V), and non-targeting control shRNA (sc-108080) lentiviral particles were purchased from Santa Cruz Biotechnology.

Techniques: Expressing, Flow Cytometry, Staining, shRNA

Journal: bioRxiv

Article Title: Type I Interferon Signaling Drives Microglial Dysfunction and Senescence in Human iPSC Models of Down Syndrome and Alzheimer’s Disease

doi: 10.1101/2021.12.22.473858

Figure Lengend Snippet: (A) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression in three pairs of Cont and DS hiPSC lines. (n = 3, each experiment was repeated three times), Student’s t test, *** P <0.001. Data are presented as mean ± SEM. (B) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression in two DS hiPSC lines expressing IFNAR1/2 shRNA or Cont shRNA , (n = 5, each experiment was repeated five times), Student’s t test, *** P <0.001. Data are presented as mean ± SEM. (C) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression in 3-4-month-old chimeric mice, Cont, DS + Cont shRNA and DS + IFNAR1/2 shRNA chimeras (n = 3 mice per group). Student’s t test, * P < 0.05 and ** P < 0.01. Data are presented as mean ± SEM. (D) Western blotting analysis of IFNAR2 expression in DS, DS + Cont shRNA and DS + IFNAR1/2 shRNA microglia cells (n = 3, each experiment was repeated three times). One-way ANOVA test. *** P <0.001. Data are presented as mean ± SEM. (E) Representative images of hTMEM119 and hN in DS + Cont shRNA and DS + IFNAR1/2 shRNA in chimeric mice. Scale bar: 50 μm. (F) Quantification of the percentage of hTMEM119 in hN + cells in DS + Cont shRNA and DS + IFNAR1/2 shRNA chimeric mice (n = 7 mice per group). Student’s t test, NS , not significant. Data are presented as mean ± SEM. (G) Representative raw fluorescent super-resolution, 3D surface rendered, and 3D skeletonization images of hTMEM119 staining in Cont, and DS + Cont shRNA and DS + IFNAR1/2 shRNA chimeric mice. Scale bar: 5 μm. (H) Representative super-resolution and 3D surface rendered images showing hTMEM119 and CD68 staining in Cont, and DS + Cont shRNA and DS + IFNAR1/2 shRNA chimeric mice. Arrows indicate PSD95 + puncta in the CD68 + phagolysosome. Scale bar: 5 μm. (I) Quantification of microglial volume, process length, branch numbers and endpoints (n = 118-136 from 3-4 mice per group), One-way ANOVA test. * P < 0.05, ** P < 0.01 and *** P < 0.001. Data are presented as mean ± SEM. (J) Quantification of CD68 + phagolysosome volume (n = 128-136 from 3-4 mice per group). One-way ANOVA test, * P < 0.05 and ***p < 0.001. Data are presented as mean ± SEM.

Article Snippet: IFNAR1 shRNA (sc-35637-V), IFNAR2 shRNA (sc-40091-V), and non-targeting control shRNA (sc-108080) lentiviral particles were purchased from Santa Cruz Biotechnology.

Techniques: Expressing, shRNA, Western Blot, Staining

Journal: bioRxiv

Article Title: Type I Interferon Signaling Drives Microglial Dysfunction and Senescence in Human iPSC Models of Down Syndrome and Alzheimer’s Disease

doi: 10.1101/2021.12.22.473858

Figure Lengend Snippet: (A) Representative images of Iba + /hN + human microglia in Cont tau and DSAD tau groups. Arrows indicate Iba + /hN + human microglia. Asterisks indicate fragmented processes. Scale bars: 50 and 10 μm. (B) Representative images showing colocalization of hCD45 + and Ferritin + staining in Cont and DSAD tau groups. Arrows indicate Ferritin + and/or hCD45 + staining. Scale bar: 50 μm. (C) Quantification of the percentage of hN + in Iba-1 + cells in Cont and DSAD tau groups (n = 7 mice/group). Student’s t test, NS , not significant. Data are presented as mean ± SEM. (D) Quantification of the process length, soma size, soma size/process length cells (n=7 mice per group). Student’s t test, * P < 0.05, ** P < 0.01, *** P < 0.001, NS , not significant. Data are presented as mean ± SEM. (E) Quantification of the percentage of Ferritin in hCD45 + cells (n = 6-7 mice per group). Student’s t test, ** P < 0.01. Data are presented as mean ± SEM. (F) A Dot plot representing the expression of the inflammation-related genes IL1β , CCL2 , CCL4, CHI3L1, KLF2, NFKBIA identified from scRNA-seq. (G) qPCR analysis of IL-1B and TNFA mRNA expression (n = 4 mice per group). Student’s t test, * P < 0.05. Data represented as mean ± SEM. (H) qPCR analysis of IFNA1 and IFNB1 mRNA expression (n = 4 mice per group). Student’s t test, *** P < 0.001. Data represented as mean ± SEM. (I) Flow cytometry analysis showing the expression of IFNAR1 and IFNAR2 in Cont tau and DSAD tau group (n=2 mice per group). (J) Representative images of human microglia (Iba + hN + ) in DS+Cont shRNA +DSAD tau and DS+IFNAR1/2 shRNA +DSAD tau chimeric mice. Arrows indicate Iba + /hN + human microglia. Asterisks indicate fragmented processes. Scale bar: 50 and 10 μm. (K) Representative image showing colocalization of hCD45 + and Ferritin + staining in DS+Cont shRNA +DSAD tau and DS+IFNAR1/2 shRNA +DSAD tau chimeric mice. Arrows indicate Ferritin + and/or hCD45 + staining. Scale bar: 50 μm. (L) Quantification of the process length, soma size, soma size/process length (n = 4 mice per group). One-way ANOVA test, ** P < 0.01 and *** P < 0.001, NS , not significant. Data are presented as mean ± SEM. (M) Quantification of the percentage of Ferritin in hCD45 + cells (n = 5 mice per group). One-way ANOVA test, * P < 0.05, NS , not significant. Data are presented as mean ± SEM.

Article Snippet: IFNAR1 shRNA (sc-35637-V), IFNAR2 shRNA (sc-40091-V), and non-targeting control shRNA (sc-108080) lentiviral particles were purchased from Santa Cruz Biotechnology.

Techniques: Staining, Expressing, Flow Cytometry, shRNA

Journal: bioRxiv

Article Title: Type I Interferon Signaling Drives Microglial Dysfunction and Senescence in Human iPSC Models of Down Syndrome and Alzheimer’s Disease

doi: 10.1101/2021.12.22.473858

Figure Lengend Snippet: (A) Representative raw fluorescent super-resolution, 3D surface rendered, and 3D skeletonization images of mouse microglia (Iba + hN - ) in Cont tau and DSAD tau chimeric mice. Scale bar: 5 μm. (B) Quantification of the process length, branch numbers, and endpoints in mouse microglia (Iba + hN - ) (n = 7 mice per group), Student’s t test, *P < 0.05, ** P < 0.01. Data are presented as mean ± SEM. (C) qPCR analysis of IFNAR1 and IFNAR2 mRNA expression (n = 4 mice per group). Student’s t test, NS , not significant. Data are presented as mean ± SEM. (D) qPCR analysis of IFNA1 and IFNB1 mRNA expression (n = 4 mice per group). Student’s t test, *** P < 0.001. Data are presented as mean ± SEM.

Article Snippet: IFNAR1 shRNA (sc-35637-V), IFNAR2 shRNA (sc-40091-V), and non-targeting control shRNA (sc-108080) lentiviral particles were purchased from Santa Cruz Biotechnology.

Techniques: Expressing

Journal: Physiological Genomics

Article Title: RNA sequencing in human HepG2 hepatocytes reveals PPAR-α mediates transcriptome responsiveness of bilirubin

doi: 10.1152/physiolgenomics.00028.2019

Figure Lengend Snippet: RNA sequencing of the transcriptome responsiveness in PPAR-α-shRNA and Scramble-shRNA HepG2 hepatocytes. PPAR-α knockdown (KD) and Scramble-shRNA (Scramble) hepatocytes were treated with biliverdin (BV) [50 μM] or vehicle (Veh) in dialyzed serum for 24 h. A: heat map for genes changed with BV and Veh in PPAR-α KD and Scramble hepatocytes with a fold >2 and <−1.6. B: volcano plots for Scramble (BV versus Veh) and PPAR-α KD (BV versus Veh). C: Venn diagram with a minimum absolute fold change of 2 and false discovery rate (FDR) P value < 0.05. Yellow, genes changed with BV treatments in Scramble; light blue, genes changed in PPAR-α KD cells with BV treatment. The overlap is genes that were changed by BV in both cell types (n = 3).

Article Snippet: In brief, human PPAR-α shRNA (CCGTTATCTGAAGAGTTCCTGCAAGAAAT) or scramble shRNA control (TR30007) in pGFP-V-RS backbone was purchased from Origene and cotransfected with vectors expressing REV and VSV-G into GP2-293 cells to generate a third-generation lentiviral construct.

Techniques: RNA Sequencing Assay, shRNA

Journal: Nature cancer

Article Title: EGFR inhibition triggers an adaptive response by co-opting antiviral signaling pathways in lung cancer

doi: 10.1038/s43018-020-0048-0

Figure Lengend Snippet: A. HCC827 cells were stably infected with lentivirus control shRNA (shCtrl) or shRNA for IFNAR1 lentivirus and silencing was confirmed by Western blot. Silenced clones were studied in AlamarBlue cell survival assays following erlotinib exposure for 72h. Cells with stable silencing of IFNAR1 (clone #3) or control shRNA were subcutaneously injected into 8 nude mice per group. The rate of tumor formation was 5–8 per group as shown in the Source_Data_Fig.7 (n=5–8). Erlotinib was administered orally at 6.25 mg/kg/day. Tumor sizes were monitored as described in the Methods section. Representative tumor images are shown. B. A similar experiment was performed with A549 xenografts (shIFNAR1 clone #2). Eight nude mice were injected per group and the rate of tumor formation was 5–8 as shown in the Source_Data_Fig.7 (n=5–8). Erlotinib was used at 100 mg/kg/d. C. HCC4190 EGFR mutant PDX was subcutaneously implanted on NOD-SCID mice. Eight nude mice were implanted per group and the rate of tumor formation was 7–8 as shown in the Source_Data_Fig.7 (n=7–8). Mice were orally treated with 6.25 mg/kg/day erlotinib and/or i.p. injected with 2 mg/kg/day anifrolumab, a monoclonal IFNAR1 antibody. D. A similar PDX experiment was performed with HCC4087, which harbor mutant KRAS and wild-type EGFR. Eight nude mice were injected per group and all 8 mice formed tumors (n=8). Erlotinib was used at a dose of 100 mg/kg/d. E. KRAS LSL-G12D transgenic mice were generated as in the Methods section, and randomly divided into 4 groups (n=3–4 as the number of dots), receiving vehicle, oral erlotinib of 100 mg/kg/day, i.p. injection of mouse anti-mouse IFNAR1 antibody at 3 mg/kg/day, and combination administration of erlotinib plus IFNAR1 antibody for 28 continuous days. Bi-weekly MRI scanning was used to monitor tumor growth. Tumor sizes were calculated by ImageJ. Representative MRI images are shown, n=3–4 as indicated by the number of dots (mice). The tumors grow as diffuse lung opacities and “H” refers to heart. Data (A-E, in vivo) refers to mean ± S.E.M. of tumor sizes (n as above), *: p<0.05, **:p<0.01, ***:p<0.001, by two-way ANOVA adjusted by Bonferroni’s. For in vitro experiments (A-B), n=3 technical replicates, representative of 3 independent repeats with similar results. Western blots are cropped and representative of three independent repeated experiments with similar results. Uncropped are in Source_Data_Fig.7. Numerical source data for the experiments in this figure can be found in Source_Data_Fig.7.

Article Snippet: Lentiviruses for establishing stable cell lines used for xenograft experiments were obtained from Santa Cruz Biotechnology (Dallas, TX), including shTBK1(sc-39058-V), shIRF3(sc-35710-V), shIFNAR1(sc-35637-V) Human Lentiviral Particles, and Control shRNA Lentiviral Particles-A(sc-108080).

Techniques: Stable Transfection, Infection, shRNA, Western Blot, Clone Assay, Injection, Mutagenesis, Transgenic Assay, Generated, In Vivo, In Vitro